Rapeseed (Brassica napus L.) was one of the major sources for edible vegetable oil in China, which also has various uses for feeding, adoption, honey, sightseeing, soil improvement and industry. With rapid development and wide application of new techniques in genome sequencing, genotyping, and phenotyping, major achievements in functional genomics have been achieved in B. napus in recent years, including identification and cloning of genes related to agronomically important traits. Here we summarized the research progress of rapeseed functional genomics, listed the key genes and their functions controling agronomically traits such as seed yield, seed quality, flowering time, plant architecture and resistance to biotic and abiotic factors, and discussed the application potential and strategies of these key genes in breeding by molecular design in B. napus. This review might provide a valuable reference for cultivating excellent rapeseed cultivars and would be of great significance to ensuring the safety of oil supply in terms to key germplasms in China.
Based on the world vegetable oilseeds trade data, the topology, overall structural characteristics, individual centrality and community layout evolution of the global vegetable oilseeds trade network from 2003 to 2021 were studied by using social network analysis methods. The results reveal that: 1) with the passage of time, the global trade volume of vegetable oilseeds continues to grow, the formed trade network is more closely interconnected, showing a trend of centralization, and the characteristics of "small world" and scale-free nature become more prominent; 2) The distribution pattern of the community of the global vegetable oilseeds trade network has been deeply adjusted, and the community structure is closer and the geographical distance is more likely to form associations; 3) Countries such as China and India in Asia, France, Germany and the Netherlands in Europe, Brazil and Argentina in South America, the United States and Canada in North America, and Australia in Oceania hold high core positions in the trade of vegetable oilseeds. Additionally, Turkey, Mexico and Paraguay also hold pivotal position in the international trade of vegetable oilseeds; 4) China's dependence on vegetable oilseeds imports has decreased significantly, but it is still mainly concentrated in Brazil and the United States. In this regard, it is suggested that China should promote diversified development of vegetable oilseeds import products and markets, expand export income generation, and make full use of the international trade platform mechanism to promote the high-quality development of China's vegetable oilseeds trade.
Based on the trade data of specific oilseed crops from 2002 to 2021, this paper analyzes the trade characteristics of sunflower seeds, sesame seeds and oil flax seeds by using GL index, BI index and Thom & McDowell index, and then summarizes the main forms of specific oilseed crops industry trade in China. The influencing elements of intra-industry trade are examined using a panel Tobit model, and appropriate countermeasure recommendations are made to ensure the security of China's specific oilseed crops business. The results indicate that in recent twenty years, the trade of China's specific oilseed crops industry is mainly inter-industry trade, and it is the primary source of trade increment. In the composition of intra-industry trade, the level of vertical intra-industry trade is greater than that of horizontal intra-industry trade. Through the empirical analysis of the factors affecting intra-industry trade, it is known that the differences in consumption preferences, products and trade distance have a significant impact on intra-industry trade of specific oilseed crops. In order to improve the trade level of China's specific oilseed crops industry, stabilize inter-industry trade and promote intra-industry trade, it is suggested that comprehensive measures should be taken to improve the domestic effective supply level of specific oilseed crops, implement differentiated development strategy, enhance the anti-risk ability and international competitiveness of China's specific oilseed crops industry, coordinate the effective connection between industrial policy and trade policy, ensure the safety of China's specific oilseed industry and promote its healthy and sustainable development.
The application of nitrogen fertilizer can improve crop yield and economic benefits. However, improper nitrogen application may lead to reduced crop yield, resources wastage and a series of environmental problems. Therefore, how to improve flax seed yield and nitrogen fertilizer utilization efficiency at the same time is an important challenge in the producing process. This paper reviews the biological characteristics of oil flax regarding nitrogen demand, the effects of nitrogen application on flax growth, physiology and yield, the factors influencing nitrogen absorption and utilization efficiency from agricultural measures, and summarize problems existing in the production. In addition, the future research was expected to provide reference for improving nitrogen use efficiency of oil flax.
Chloroplast-related mutants are excellent genetic resources for studying physiological pathways such as photosynthesis, chlorophyll biosynthesis, and chloroplast structure development. They also have certain application values as marker traits in breeding. Our research team discovered a cotyledon yellowing to lethal mutant ytl （yellowing to lethal） from the recurrent selection population of restorer lines. The mutant remained yellowing state after germination and died after 9-15 days of sowing. Previous studies identified a locus trait of cotyledons on the C09 chromosome. Phenotypic observations showed that there were significant differences in plant height and root length between the mutant and the wild-type after 7 days of emergence, which were significantly shorter. Genetic analysis shows that the mutant is controlled by two pairs of recessive nuclear genes. Using unit point segregation population to locate BnaC02.YTL within the physical interval of 418 kb corresponding to the ZS11 reference genome, combined with quantitative analysis and gene comparison sequencing, BnaC02G0055700ZS was identified as a highly likely candidate gene. This study lays the foundation for further precise mapping of the gene BnaC02.YTL and subsequent functional research of mutants.
In order to understand the role of GA in heterosis of Brassica napus at seeding stage and effect of temperature on GA synthesis. In this study, the hybrid combination YG2009 × YC4 with strong yield advantage of hybrid F1 and its parents YG2009 and YC4 were selected as experimental materials, which grew at 5, 15 and 25℃, respectively. The relationship between agronomic traits and total GA content of hybrid F1 and parents at 20 days of seedling age and the trend of total GA content with temperature were analyzed, and the relative transcription level of key enzyme genes in GA synthesis pathway was analyzed by qPCR. The results showed that temperature significantly affected the GA content in B. napus seedlings, which in turn affected the growth of seedlings. With the increase of temperature, the phenotypic traits such as plant height, leaf number, leaf width, leaf length, fresh weight and dry weight of different materials showed a significant upward trend. The total GA content in plants changed significantly with temperature. Canonical correlation analysis showed that phenotypic traits were positively correlated with the total GA content, that is, the total GA content increased, which was beneficial to the growth of B. napus seedlings. The total GA content in YG2009 × YC4 plants increased with the increase of temperature, and reached the highest at 25℃. The total GA content in YG2009 × YC4 plants was 83.01 % higher than that of female parent YG2009 and 100.72 % higher than that of male parent YC4, reaching a significant difference level. At 25℃, the relative transcription level analysis of key enzyme genes of GA metabolism in different parts showed that there were different transcriptions of key enzyme genes in different parts of B. napus, resulting in a large difference in the total GA content in each part. Grey correlation analysis showed that the relative transcription level of GA2ox6 had the highest grey correlation degree with the total GA content in roots, the relative transcription level of GID1 had the highest grey correlation degree with the total GA content in stems, and the relative transcription level of GA20ox4 had the highest grey correlation degree with the total GA content in leaves. It was speculated that the relative transcription levels of GA2ox6, GID1 and GA20ox4 had a great influence on the total GA content in plants.
Functional marker (FM) is one of the most useful molecular markers in crop breeding, which facilitates the realization of high-throughput genotyping and marker-assisted selection (MAS). In this study, 22 KASP markers were developed according to the reported functional loci of important traits in soybean, including stem growth habit (Dt1), multi-seed pods (Ln), shattering pods (Pdh1), seed size (GmSSS1, GmST05), flowering time (J, GmPRR3a, GmPRR3b, GmFUL2a, GmLHY1a, GmLHY1b, GmSOC1a, E4), protein and oil content (GmSWEET39), carotene content (GmCCD4), phosphorus use efficiency (GmPHF1), nitrogen use efficiency (GmGLP20.4), symbiotic compatibility in nodulation (Rj2) and cytokinin biosynthesis (GmCXK7-1). All of the 21 markers could be used to accurately classify heterozygous and homozygous genotypes, except that the marker of e4-sore could not distinguish heterozygous samples. Combining with phenotypic information, the selection efficiency of multi-seed pod, leaf shape and stem growth habit markers was analyzed. The results showed that the selection efficiency of multi-seed pod (Ln) markers on phenotype was 84.0%, that on leaf shape was 94.8%, and that of stem growth habit (Dt1) markers on phenotype was 87.4%, showing a high level of selection accuracy. The 22 functional markers developed in this study can be used to accurately identify the genotypes and have important utilization value in marker assisted breeding of soybean.
In the past decades, whitefly has occurred on a large scale in the main soybean producing areas of China, which seriously affecting soybean production. Thus, based on the 192 soybean natural populations genotyped by Illumina Soy6K SNP chip, genome-wide association study on soybean resistance to whitefly was performed by a mixed linear model. A total of 3 SNP loci significantly associated with soybean whitefly resistance were identified, including Gm07_36488859, Gm11_37409028 and Gm18_2054425. According to allelic effect analysis, gene annotation and expression, Glyma07g31470 and Glyma11g35670 were predicted as candidate genes regulating soybean resistance to whitefly.
To evaluate the genetic diversity of 58 sesame local germplasm resources collected from 38 counties in Shanxi Province during the Third Crop Germplasm Resource Census and Collection Action in 2020, field investigations were conducted on 41 phenotypic traits of 57 resources. The study was conducted using coefficient of variation, genetic diversity index, correlation coefficient, and cluster analysis methods, and excellent germplasm was screened. The results revealed abundant genetic variations in quantitative traits, with an average genetic diversity index of 1.826 for 27 traits. 1000-grain weight showed the highest genetic diversity index (2.09), and calyx length exhibited the lowest (1.23); The height of the initial branch exhibited the highest coefficient of variation (72.05%), and the growth period showed the lowest(4.01%). The length of the corolla, the height of the initial branch, the length of the main stem fruit axis, the length and thickness of the capsule, the length and width of the basal and middle leaves are significantly positively correlated with the yield per plant. Cluster analysis divided the resource into five groups: materials with multiple branches and high yield;dwarf type; a long growth period with multiple branches but low yield type; high stem, high yield, and large grain; and those has moderate comprehensive traits and has potential for increasing yield after improvement. Excellent germplasm resources were selected based on comprehensive phenotypic traits, including P141028023, P141032019, P140502022, and P140830014. This study provides theoretical reference for the excavation and utilization of sesame local germplasm, and provides excellent parental materials for new variety breeding.
Sunflower rust is one of the most important diseases of sunflower, leads to a serious decline in sunflower output and quality. However, the key disease-associated genes of sunflower rust are still not clear, so, there is no specific targets for prevention. Identifying the pathogenic factors and mechanism of rust is essential for disease control strategies. Our team found that the extracellular metalloprotease PhMEP1 plays an important role in the pathogenesis of disease. In order to further clarify its pathogenic mechanism, in this study, we first identified the sites where the protein interacts with host. The transport of proteins depends on a signal sequence with complex physiological functions. The signal peptide (SP) of PhMEP1 is a signal sequence that can be cleaved, but the protein transport depends on it. The signal peptide sequence of PhMEP1 was analyzed for structure and function using bioinformatics software, and the results suggested that the signal peptide was the front 22 amino acids of the ORF region. Then, the secretory function of the signal peptide was verified by using the yeast secretion system is to adopt a different media and color reactions whether the signal peptide has secretory function or not. The results showed that the yeast transformants of the signal peptide fusion protein could grow normally on YPRAA medium, the secretion of invertase and the hydrolysis of raffinose into monosaccharides were also confirmed with 2, 3, 5-triphenyltetrazolium chloride (TTC), which reacts with monosaccharides to form the insoluble triphenylformazan (TPF). To determine whether the signal peptide has a secretory function in the pathogen-plant interaction, it was used western blot to expression of the signal peptide fusion protein in tobacco cells. The results showed that the signal peptide fusion protein was detected in tobacco apoplastic fluid (AF), indicating that the fusion protein could be transferred to the intercellular after having the signal peptide of PhMEP1. These results suggest that the signal peptide of PhMEP1 has secretion activity, the protease was released to extracellular space to perform the function.
Tonoplast intrinsic proteins (TIPs), which constitute a subfamily of aquaporin facilitating the movement of water at vacuolar membranes, play a key role in growth, development, and stress response of plants. Tigernut (Cyperus esculentus), which initially originated in Africa and Mediterranean, is a novel herbaceous oil crop uniquely accumulating high levels of oil in underground tubers. Based on available genome and transcriptome data, in this study, a tuber-abundant TIP gene named CeTIP1;1 was cloned and characterized. This gene was shown to possess two introns with a coding sequenceof756 bp, putatively encoding 251 amino acids with the molecular weight of 25.75 kDa, the isoelectric point of 6.01, the instability index of 24.90, the grand average of hydropathicity of 0.831, and the aliphatic index of 107.77, implying its stable, acidic, and hydrophobic features. The protein includes one conservative major intrinsic protein (MIP) domain specific to aquaporins. Phylogenetic analysis indicated that CeTIP1;1 clusters with OsTIP1;1 and exhibits a relatively high sequence similarity of 92.83%, supporting that it is a TIP1 homolog. Subcellular localization analysis showed that CeTIP1;1 was indeed localized to the vacuolar membrane of Nicotiana tabacum leaves. Expression analysis revealed a constitutive and high level expression of CeTIP1;1 in all tissues examined in this study. Moreover, CeTIP1;1 was shown to exhibit a bell-like expression pattern during tuber development. These results laid a solid foundation for further uncovering the mechanism of water balance in tigernut tubers.
To investigate the effects of applying calcium fertilizer on peanut reproductive growth in barren red soil dry land, this study selected the large grain variety Xianghua 2008, the medium grain variety Xianghua 55, and the small grain variety Lanshanxiaozi. Two treatments were set up: one with calcium fertilizer application and the other without. Column cultivation was conducted, and the developmental dynamics of peanut flowers, pegs, and pods were observed and measured. The results indicated that: (1) Application of calcium fertilizer promoted early flowering, controlled mid-late flowering, and shortened the flowering period. The total number of flowers for large, medium, and small-sized varieties decreased by 50.59%, 38.47%, and 26.55% respectively. It reduced the number of flowers at higher positions while increasing the number of flowers at lower positions, thus enhancing the overall flowering within the effective flowering period. (2) Applying calcium increased the total number of fruit needles in the early stage, while decreasing the number of fruit needles in the later stages of development and the number of non-embedded fruit needles. However, the impact on the number of non-embedded fruit needles in the early stages was not significant. Among them, calcium fertilizer had a greater effect on large-sized varieties compared to medium-sized and small-sized varieties, resulting in reductions of 68.38%, 53.55%, and 54.83% respectively. (3) Calcium application increased the total number of fruits, especially medium and large-sized fruits, while reducing the number of immature fruits in the later stages. Furthermore, the impact of calcium fertilizer on large and medium-sized peanut varieties was greater than on small-sized varieties. (4) Application of calcium fertilizer improved yield with better outcomes observed in larger-sized peanut varieties compared to medium and small-sized ones. Therefore, variations in the adaptability of different peanut varieties to calcium-deficient red soil in the southern area exist. From a crop yield perspective, it is suggested to utilize larger-sized peanut varieties and enhance the application of calcium fertilizer during cultivation.
In order to achieve high yield of summer-planting peanut, on the basis of years of research, our team created a high-yield cultivation technology of “Three Increase and Three Precision” for summer-planting peanut: Increase accumulated temperature by watering after sowing; Increase the density to expand the group; Increase the application of calcium fertilizer to promote pod filled completely; Precision fertilization by phased nitrogen supply; Precision sowing by planting seed orientation; Precision regulation by “three prevention and three promotion”. In order to verify the effects of “Three Increase and Three Precision” technology on the population quality optimization and yield increasing of summer-planting peanut, eight treatments were set up, including CK (Control), I1 (Watering after sowing), I2 (Increasing density), I3 (Increasing calcium fertilizer application), P1 (Phased nitrogen supply), P2 (Seed orientation planting), P3 (Three control and three promotion) and TT (Three increase and three precision), to study their effects on the agronomic characters and yield composition of summer-planting Peanut. The results showed that compared with other treatments, the emergence stage of “Three Increase and Three Precision” technology system was 3 days earlier than that of the control because it integrated the advantages of “Watering after sowing” and “Seed orientation planting”, and the emergence rate was also increased by 5.90%. Besides that, it also inhibited main stem elongation, promoted lateral branch differentiation, and increased the number of branches by 12.90% compared with the control. The green leaf number of main stem was increased by 16.84%, which was conducive to the construction of ideal plant type. Compared with control, it could significantly increase the activity of protective enzymes in mature leaves, the activities of SOD, POD and CAT increased by 17.44%, 14.54% and 34.82%, respectively, while the content of MDA decreased by 15.61%, which effectively alleviate leaf aging. The number of harvested plants increased by 15.35% compared with control; the number of full pods per plant and the pods weight per plant by 54.07%, 47.06%, and 55.35% respectively compared with control, resulting in a significant increase of 79.06% in pod yield, and the actual acceptance yield was 619.31kg/667m2, created the record of summer-planting production. In conclusion, the high-yield cultivation technology of “Three Increase and Three Precision” of summer-planting peanut can fully tap the production potential of summer-planting peanut according to the growth characteristics of wheat stubble, which is beneficial to achieve high yield.
The specific root exudate, tripropylene glycol monomethyl ether (TPM), was significantly increased under the maize and peanut intercropping system. Exploring its effects on the growth and metabolic physiology of peanut plants could provide reference for exploring effective substances regulating the growth and development of peanut and promoting the quality and yield improvement of peanut. In this study, Qinghua No.6 peanut variety was used as experimental material, and the same volume of sterile water was added as control (CK). The dry matter accumulation, maximum photochemical efficiency, carbon and nitrogen metabolism enzyme activity and antioxidant properties of peanut plants under three tripropylene glycol monomethyl ether (TPM) adding gradient (T1:10.23μL/pot, T2:20.46μL/pot, T3: 40.92 μL/ pot) were studied. The results showed that, compared with CK, T1 and T3 significantly reduced the above-ground dry matter weight of peanut plants. All TPM treatments significantly reduced the dry matter weight of underground part and maximum photochemical efficiency (Fv/Fm) of PSⅡ. TPM supplementation significantly increased the activity of carbon and nitrogen metabolizing enzymes in peanut functional leaves, for detail, the activities of nitrate reductase (NR), sucrose synthetase (SS) and phosphate sucrose synthetase (SPS) in T1 treatment were increased by 6.49%-203.24% compared with CK, and Glutamine synthetase (GS) activity in T3 treatment was significantly increased by 39.81% compared with CK. The supplementation of TPM had stress effect on peanut plants. The content of malondialdehyde (MDA) was significantly increased by 17.32%-34.65% compared with CK. The activities of superoxide dismutase (SOD) and catalase (CAT) under T3 treatment were decreased by 75.82% and 75.74% compared with CK, respectively. The peroxidase (POD) activity under T1 treatment was significantly decreased by 30.43% compared with CK. According to the histochemical localization, T3 treatment significantly induced the accumulation of H2O2 and O2 - in peanut plant functional leaves, and the content of O2 - was significantly increased by 83.39% compared with CK. In conclusion, TPM can inhibit the growth of peanut plants, especially the underground part, reduce the potential maximum photosynthetic capacity (Fv/Fm) of leaves and inhibit the activities of antioxidant enzymes such as SOD, CAT and POD. However, peanut plants can reduce the damage caused by TPM by improving the activities of carbon and nitrogen metabolic enzymes such as NR, SS, SPS and GS. In this study, TPM is not suitable for peanut production.
Root morphology, photosynthetic characteristics, and yield formation of peanut genotypes were investigated under drought-rewatering conditions during the flowering and sub needling stages to elucidate the physiological and ecological mechanisms by which drought stress affects high-yield peanut production. Drought-tolerant varieties NH9 and HY22, as well as drought-sensitive varieties NH16 and NH21, were used as test materials in potting experiments with controlled water supply. The results demonstrated that drought stress during the flowering-needling stage significantly impeded root dry matter accumulation in all four peanut varieties. The degree of inhibition increased with prolonged stress duration, resulting in decreases ranging from 11.22% to 21.01%, 11.83% to 14.68%, 38.78% to 44.40%, and 31.94% to 40.16% for NH9, HY22, NH16, and NH21 respectively. Under drought stress, the photosynthetic gas exchange parameters and chlorophyll fluorescence parameters of the four peanut varieties were significantly reduced. However, there was an increase in chlorophyll content, and NH9 and HY22 exhibited relatively higher values of Gs and Ci compared to NH16 and NH21. The impact on chlorophyll fluorescence parameter values (Fv/Fm, ΦPSII, Rfd, qP) was less pronounced, while the increase in NPQ and chlorophyll content did not reach a significant level. Drought stress during flowering and needle-down stages had a substantial effect on peanut yield. The yield per plant decreased by 3.67%-13.04%, 4.32%-13.04%, 18.19%-36.61%, and 14.53%-39.25% for NH9, HY22, NH16, and NH21, respectively. The reduction in yield for drought-tolerant varieties was primarily attributed to a decrease in the number of full fruits per plant; whereas for drought-sensitive varieties it was also due to a decrease in the number of full fruits per plant with additional influence from other factors such as pod formation. After re-watering, the root growth, dry matter accumulation, and photosynthetic characteristics of NH9 and HY22 were rapidly restored to normal levels, even exhibiting super-compensatory effects. Meanwhile, the inhibitory effect on NH16 and NH21 was alleviated but still differed from the control group, particularly in terms of indicators such as root dry weight, root surface area, Pn (photosynthetic rate), and Rfd (quantum yield of PSII). Overall, variations in peanut genotype yield reduction primarily resulted from differences in the number of full fruits per plant. In conclusion, the distinct response patterns to drought stress among different peanut genotypes can be attributed to the superior drought resistance of NH9 and HY22 due to their well-developed root morphology and adapted photosynthetic capacity.
In order to understand the physiological mechanism of drought stress affecting premature leaf senescence of the pod subtending leaf during flowering and pod period, a pot experiment was conducted in Hefei, Anhui Province from 2021 to 2022. The effects of drought stress on the endogenous protective enzyme system and ascorbate glutathione cycle were studied based on the antioxidant metabolism system at soil water content (SWC) (75 ± 5)%, (60 ± 5)% and (45 ± 5)% on two soybean varieties (Wandou 37, drought weak sensitive variety; Wandou 38, drought sensitive variety). The results revealed that drought accelerated the senescence of pod subtending leaf, with SPAD decreasing by 8.0%-24.2% for Wandou 37 and by 12.4%-32.9% for Wandou 38. The activities of superoxide dismutase (SOD) and peroxidase (POD) and the content of ascorbic acid (ASA) were significantly increased in the pod subtending leaf, however the activities of ascorbate oxidase (APX), dehydroascorbate reductase (DHAR) and glutathione reductase (GR) were inhibited by drought stress. A large amount of H2O2 and O2 - could not be completely removed, resulting in the increase of H2O2 and MDA content, and the increase of O2 - production rate, which resulted in acceleration of leaf senescence. SWC (45 ± 5)% treatment was significantly higher than SWC (60 ± 5)% treatment, and the results were consistent between the two varieties. Compared with Wandou 38, Wandou 37 had higher GR and PAX activities under drought stress, increased ASA content, reduced H2O2 and O2 - accumulation, and reduced the degree of membrane lipid peroxidation. Therefore it improved the resistance to drought adversity.
To investigate the effect of nitrogen on soil nutrients and microbial communities in peanut field with wheat straw returning under wheat peanut rotation mode, four nitrogen levels (N: 0, 45, 90, and 180 kg/hm2) were set to study the soil nutrient content, soil enzyme activity, soil bacterial community structure and diversity during podding stage. The results showed that under the same nitrogen level, straw returning increased soil nutrient content and soil enzyme activity in peanut field at pod setting stage. Compared to the corresponding nitrogen level, the increase of total nitrogen content and total carbon content in soil with straw returning were 12.8%-23.1% and 20.9%-35.4% respectively, and the increase of microbial biomass carbon and nitrogen content were all higher than 48.3%. Wheat straw returning also affected the relative abundance of bacteria in phylum level and the function of bacteria. Under wheat straw returning conditions, the soil microbial carbon and nitrogen content, soil enzyme activity, and peanut yield all showed a trend of first increasing and then decreasing with the increase of nitrogen application rate. Under 45 kg/hm2 nitrogen level, the microbial biomass carbon and nitrogen content were highest, the activities of invertase and cellulase were highest, the soil bacterial richness index was high, and the relative abundance of Proteobacteria and Acidobacteria was most affected by wheat straw returning. Addition, there was no significant difference in soil total nitrogen, total carbon content, and peanut yield between 45 and 90 kg/hm2 nitrogen level. Correlation analysis showed that the composition of soil bacterial community of each treatment was affected by the soil total nitrogen, total carbon, ammonium nitrogen, and microbial biomass carbon and nitrogen content. The results indicate that wheat straw returning and nitrogen application not only affect the soil nutrient content and soil enzyme activity, but also affect the composition of soil bacterial community during peanut pod setting stage. Under the condition of wheat straw returning, the nitrogen application of 45 kg/hm2 can not only ensure stable peanut yield, but also increase the microbial biomass carbon and nitrogen content in soil during the pod setting stage and improve the soil micro ecological environment. Therefore, the amount of nitrogen fertilizer application can be reduced in the production of peanut with wheat straw returning.
Peanut production in our country constantly suffers from the risk of Aspergillus flavus infection and aflatoxin pollution, especially in peanut producing areas along Yangtze River Basin. Based on the preliminary development of the microbial agent ARC-BBBE by the team, the demonstration technology of ARC-BBBE peanut production was carried out in four provinces (Hubei, Hunan, Jiangxi and Sichuan) in the peanut producing areas of Yangtze River Basin in 2022. The research results showed that: in the peanut producing areas of the Yangtze River Basin, the inhibition ratio of Aspergillus flavus abundance in soil by ARC-BBBE ranged from 36.87% to 94.70%, with an average inhibition ratio of 63.02%. At the same time, ARC-BBBE could enhance the nitrogenase activity, increase the number and weight of peanut nodules, and increase the biomass of peanut plants. The yield increase range of peanut was 7.23%-53.85%, and the average yield increase rate was 20.58%. Comprehensive demonstration results: applying ARC-BBBE to peanut can be used as a cultivation technology to increase peanut yield per unit area, improve peanut productivity and guarantee the healthy development of peanut industry. It is strongly suggested to further expand the demonstration area.
This study aimed to investigate the effects of sowing date and density on stalk characteristics and yield formation of different plant architecture soybean varieties under soybean-corn strip intercropping. Two varieties with different of maturity periods, Nanxiadou 25 (ND25, intermediate-late maturing, branching type) and Qihuang 34 (QH34, early maturing, primary stem type) were selected to assess the effects of sowing date (S1: mid-May, S2: late May, S3: early June, 3 periods repeated in 2021 and 2022) and density (D1: 81,000 plants hm-2, D2: 101,000 plants hm-2, D3: 140,000 plants hm-2, D4: 171,000 plants hm-2) on the plant architecture and yield of soybeans in strip intercropping. Increasing density at the same sowing period resulted in shade avoidance behavior characterized by increased plant height, reduced stem diameter, increased average node length and slenderer plants in all varieties, resulting in lower stem bending force and higher lodging rate. Simultaneously, the increasing in density intensified intraspecific competition and self-shading, while reducing plant biomass per plant. The delay in sowing at the same density decreased stem diameter, stem bending force, and biomass per plant for each variety, while the average node length increased. For ND25, there was a decrease in plant height and lodging rate, whereas for QH34, there was a increase in plant height and lodging rate. The average number of branches for each treatment was 4.07 and 0.53 for ND25 and QH34, respectively, and the average branch yield contribution for each treatment was 55.30% and 5.82%, respectively. With delayed sowing, the yield of ND25 followed the order: S1 < S2 < S3, while the yield of QH34 followed: S1 > S2 > S3. With increased density, the yield of ND25 followed: D1 > D2 > D3 > D4, while the yield of QH34 followed: D3 > D2 > D1 > D4. In summary, appropriate late planting and moderate thinning were beneficial for ND25, while appropriate early planting and moderate density were beneficial for QH34, and the synergy between primary stem and branching could increase soybean population yield. It is recommended to plant ND25 appropriately late and thinly at 81 000 plants hm-2 (D1) in early June (S3), while QH34 should be planted appropriately early and densely at 140 000 plants hm-2 (D3) in mid-May (S1) for optimal yield and plant architecture.
γ-Polyglutamic acid (γ-PGA) is a non-toxic water-soluble polyamino acid produced by microbial fermentation in nature. It is a kind of polymer formed by the condensation of L-glutamic acid and D-glutamic acid through dehydration. It has the characteristics of good ductility, biocompatibility, stability and water absorption.In this experiment, γ-PGA producing strains were isolated from fermented soybean products produced in the laboratory by screening media, and the strains were identified by morphological observation, physiological and biochemical identification and 16S rRNA sequence analysis. The fermentation conditions were optimized by single factor test and orthogonal test. In order to improve the low temperature tolerance of soybean seedlings, the gamma-PGA fermentation solution of the strain was applied in soybean pot, and the effect of the fermentation solution on the cold tolerance of soybean seedlings was preliminatively investigated.The results showed that a γ-PGA producing strain was isolated, named YW-5, belonging to Bacillus velezensis. The optimal fermentation conditions were 4 g·L-1 sucrose, 1 g·L-1 beef paste, 3.5 g·L-1 monosodium glutamate, 0.03 g·L-1 potassium dihydrogen phosphate and 5.2 pH. After optimization, the yield of γ-PGA was 5.10 g·L-1. Pot experiment preliminatively proved that leaf spraying fermentation liquid can effectively reduce the MDA content of soybean seedlings under low temperature stress, increase the POD and CAT activities of soybean seedlings, and enhance the root vitality of soybean seedlings, which has good application potential.
The present study to assess the impact of different pruning methods on macadamia canopy characteristics, yield, and quality were evaluated, thus providing an important reference for management of macadamia orchards. Specifically, 10 years old trees of cultivar O.C were used and modified to trunk layered (treatment A), delayed-open layered (treatment B), and multi trunk open center (treatment C), with CK only for height control treatment. The variation of tree canopy characteristics, fruit setting rat, nut-in shell of individual, yield of individual tree, fruit quality, were evaluated for three consecutive years (September 2019 to September 2022). During this period, the overall trend of leaf area index was that CK ＞ trunk layered ＞ delayed-open layered ＞ multi trunk open center, decreased significantly in the early stage of pruning (January) and increased significantly in the late pruning stage (August). The trend of photosynthetically active radiation was opposite to that of leaf area index. The fruit setting rate, nut-in shell of individual, yield of individual tree significantly improved by pruning treatments, as well as the content of crude fat and palmitoleic acid. In general, trunk layered exhibited the highest efficacy, followed by delayed open layered, multi trunk open center, and CK. Meanwhile, the individual kernel weight and kernel rate showed significant improvements. Under the first year of the experiment, the leaf area index and photosynthetic effective radiation showed significant changes by pruning treatment. The leaf area index of treatment A, treatment B, and treatment C decreased by 60.70%, 65.17%, and 67.09%, respectively, compared with CK. Along with the experiment (2021-2022), the leaf area index and photosynthetic effective radiation decreased slightly compared to CK, for example, treatment A, treatment B, and treatment C decreased by 39.33%, 40.28%, and 42.10%, respectively. The yield varies with years, in the first year of the experiment, the yield significantly decreased by 18.57% with pruning treatment, the control and average of pruning treatment decreased to 26.30% and 15.91%, respectively. We can conclude that pruning treatment has a certain stabilizing effect on yield. In the second year of treatment, the yield rebounded significantly. The pruning treatment increased by 36.04% compare to the before treatment, however the control also increased by 3.61%. Which indicated that pruning treatment significantly improve the yield of macadamia nuts, but there is a fluctuation in yield between years. In conclusion, the canopy modification in macadamia orchard significantly improved canopy light condition, increase the fruit setting rate and the weight of a single shell fruit, and significantly increase the yield, and improve the fruit quality, especially the internal quality, such as the content of crude fat and Palmitoleic acid. Of these shapes, the effect of treatment A (trunk layered) was better than the others.
In order to enrich the biocontrol resources of Camellia oleifera root rot disease and explore its resistance mechanism, antagonistic growth-promoting bacteria were screened from endophytic bacteria of C. oleifera root by plate confrontation method and colorimetric method, and their effects on defense enzyme activities and defense genes of C. oleifera root were measured. The results showed that two strains of efficient endophytic growth promoters AF9 and AH6 were screened from the root system of C. oleifera by combining the antagonistic effect, IAA production, organic phosphorus soluble, inorganic phosphorus production and iron-producing carrier capacity. Both strains were identified as Bacillus. Both of them could increase the root defense enzyme activities, and the activities of superoxide dismutase (SOD), phenylalanine ammoniase (PAL), polyphenol oxidase (PPO), and peroxidase (POD) reached the peak at 8 h, 10 h,12 h, and 24 h, respectively. PAL, RBOHC and POD, genes were highly expressed at 10 h, 12 h, and 24 h, respectively, while no significant expression was found in control group. The results indicated that the antagonistic growth promoting bacteria AF9 and AH6 could induce systemic resistance of C. oleifera, which laid the foundation for the development of later bacteriotics and biological control of C. oleifera root rot.
Peanut sheath blight caused by Rhizoctonia solani is an significant soil-borne disease in peanut production, which can seriously threaten the safety of peanut production and quality, and is the main obstacle factor in the sustainable and healthy development of peanut industry. In this study, the isolated Trichoderma harzianum strain T-102 with excellent control efficiency was cultured by submerged fermentation technology. Under the optimal conditions of 150 r/min, 20℃ and the initial inoculation concentration of 7.5%, the water suspension of T. harzianum T-102 with 105 cfu/mL was obtained. In Linyi city, Shandong province and Tangshan city, Hebei province, the water suspension of T. harzianum T-102 exhibited the great effect for controlling peanut sheath blight in the field. After spraying the water suspension of T. harzianum T-102, the disease index of peanut sheath blight was significantly reduced. Moreover, the yield of peanut could be increased by 41.2% and 31.7% in Linyi city and Tangshan city, respectively. In addition, the water suspension treatment could change the structure and composition of microbial communities of peanut rhizosphere, and reduce the abundance of harmful microorganisms. Based on the above characteristics, the water suspension of T. harzianum T-102 is expected to carry out further commercial development and application.
Peanut is an important oil crop. However, food safety and industrial development of peanuts were limited by aflatoxin contamination. Breeding and applying resistant varieties have been effective approaches for aflatoxin control. However, progress in the identification of resistant germplasm resources and resistance breeding programs was hampered by complex, costly and unreasonable methods of A. flavus infection resistance in peanut seeds. In this study, the classification of peanut seeds after infected by A. flavus in the evaluation method was optimized and adjusted based on previous methods.The previous score for A. flavus infectione to peanuts seeds with 4 levels (referred to as "4-level score") was improved to 9 levels (referred to as "9-level score"). The results from evaluating peanut seeds infection with A. flavus using the 9-level score showed that it could better distinguish the difference inthe A. flavus infectionresistance among peanut varieties compared to the 4-level score. Furthermore, the results of comparing 9-level score and 4-level score were used in screening the A. flavus infection in a hybrid progeny population showed, the 9-level score was more efficient in identifying resistant materials and detected more QTLs in genetic linkage analysis. These results indicate that the 9-level score is an effective and stable index for A. flavus resistance peanut evaluation.
A color change-based sensitive detection method was developed using loop-mediated isothermal amplification（LAMP）. The LAMP specific primers were selected for the detection of Sclerotinia sclerotiorum. The LAMP reaction system and optimal conditions were established, followed by sensitivity and specificity tests. The results demonstrated that F3-1:ATGCCTGTTCGAGCGTCA, B3-1:AGTTCAGCGGGTATCCCTA, FIP-1:GCCGCCACTGATTTTAGAGCCTTTTCAACCCTCAAGCTCAGC and BIP-1:TCGTTACAGGTTCTCGGTGTGCCCTGATCCGAGGTCAACCAT were used as primers. The reaction system comprised 10×Bst Reaction Buffer 2.4 μL, dNTP Mixture 1.28 mmol·L-1, F3/B3 0.15 μmol·L-1, FIP/BIP 0.8 μmol·L-1, HNB 150 μmol·L-1, MgSO4 1.2 mmol·L-1, Bst DNA polymerase 0.19 U·L-1 and ddH2O 13.4 μL. Nucleic acid amplification reaction was performed at 64℃ isothermal conditions for 1h. The test results can be visually assessed with the naked eye, while agarose gel electrophoresis verification showsd clear trapezoidal amplification results. These phenomena were not observed in other tested strains such as Botrytis cinerea, phytophthora, saprophyticus, etc., indicating a strong specificity to S. sclerotinia. The minimum detection limit of LAMP technology was determined to be 1×10-3 ng·μL-1. The establishment of this method provides a novel technique for the quarantine and rapid diagnosis of the diseases caused by S. sclerotiorum.
